View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0790_low_34 (Length: 320)

Name: NF0790_low_34
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0790_low_34
NF0790_low_34
[»] chr3 (1 HSPs)
chr3 (100-223)||(13416567-13416690)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 100 - 223
Target Start/End: Original strand, 13416567 - 13416690
Alignment:
100 gtgttgaatctatttctgttggaatgtgaacatctttgtattctttctattgaattgtatgagaaggacttgtaagattgtatgaatatacattcaagga 199  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13416567 gtgttgaatctattgctgttggaatgtgaacatctttgtattctttctattgaattgtatgagaaggacttgtaagattgtatgaatatacattcaagga 13416666  T
200 ggatagatgacattggtagggtct 223  Q
    ||||||||||||||||||||||||    
13416667 ggatagatgacattggtagggtct 13416690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University