View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_low_34 (Length: 320)
Name: NF0790_low_34
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 100 - 223
Target Start/End: Original strand, 13416567 - 13416690
Alignment:
| Q |
100 |
gtgttgaatctatttctgttggaatgtgaacatctttgtattctttctattgaattgtatgagaaggacttgtaagattgtatgaatatacattcaagga |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13416567 |
gtgttgaatctattgctgttggaatgtgaacatctttgtattctttctattgaattgtatgagaaggacttgtaagattgtatgaatatacattcaagga |
13416666 |
T |
 |
| Q |
200 |
ggatagatgacattggtagggtct |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13416667 |
ggatagatgacattggtagggtct |
13416690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University