View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_low_36 (Length: 318)
Name: NF0790_low_36
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0790_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 92 - 210
Target Start/End: Original strand, 48023399 - 48023517
Alignment:
Q |
92 |
ctgtgtcttattcagattcaggtacaagtagagcaagaacatattgtgtggaagctccttgtctagattgattagaattagttgcaatgcaacaatttcc |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48023399 |
ctgtgtcttattcagattcaggtacaagtagagcaagaacatattgtgtggaagctccttgtctagattgattagaattagttgcaatgcaacaatttcc |
48023498 |
T |
 |
Q |
192 |
caagagtggacatgaatga |
210 |
Q |
|
|
||||||| ||||||||||| |
|
|
T |
48023499 |
caagagtagacatgaatga |
48023517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6937 times since January 2019
Visitors: 5773