View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0790_low_36 (Length: 318)

Name: NF0790_low_36
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0790_low_36
NF0790_low_36
[»] chr4 (1 HSPs)
chr4 (92-210)||(48023399-48023517)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 92 - 210
Target Start/End: Original strand, 48023399 - 48023517
Alignment:
92 ctgtgtcttattcagattcaggtacaagtagagcaagaacatattgtgtggaagctccttgtctagattgattagaattagttgcaatgcaacaatttcc 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48023399 ctgtgtcttattcagattcaggtacaagtagagcaagaacatattgtgtggaagctccttgtctagattgattagaattagttgcaatgcaacaatttcc 48023498  T
192 caagagtggacatgaatga 210  Q
    ||||||| |||||||||||    
48023499 caagagtagacatgaatga 48023517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University