View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_low_45 (Length: 251)
Name: NF0790_low_45
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790_low_45 |
 |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0092 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 22132 - 22360
Alignment:
| Q |
23 |
attgatggtaactataatccagatggagctcagaagtggctaaaagatgagatatcaattgtttgaaagatcgataggtacacctaggaacatttatatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22132 |
attgatggtaactataatccagatggagctcagaagtggctaaaagatgagatatcaattgtgtgaaagatcgataggtacacctaggaacatttatatt |
22231 |
T |
 |
| Q |
123 |
atatgaaaaggttgaacattggtggaataatgcttggaaggacaacgagttgagatcatgtcaactgttttttgggataagtttctgattaattacttcc |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22232 |
atatgaaaaggttgaacattggttgaataatgcttggaaggacaacgagttgagatcatgtcaactgttttttgggataagtttctgattaattacttcc |
22331 |
T |
 |
| Q |
223 |
ctggacagatttacaaccgaacaagagca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22332 |
ctggacagatttacaaccgaacaagagca |
22360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University