View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0790_low_57 (Length: 213)

Name: NF0790_low_57
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0790_low_57
NF0790_low_57
[»] chr5 (1 HSPs)
chr5 (1-127)||(16193773-16193899)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 16193899 - 16193773
Alignment:
1 catacatggaaaataaagatagctcaattaagagtagaaggaatcaatgcttctatgtctttggttctctctctaaaatgtacaagaagacaaattatta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
16193899 catacatggaaaataaagatagctcaattaagagtagaaggaatcaatgcttctatgtttttggttctctctctaaaatgtataagaagacaaattatta 16193800  T
101 gtggtgagaagagatgatgactagtat 127  Q
    |||||||||||||||||||||| ||||    
16193799 gtggtgagaagagatgatgactggtat 16193773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6341 times since January 2019
Visitors: 5767