View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_low_59 (Length: 211)
Name: NF0790_low_59
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 34780306 - 34780153
Alignment:
| Q |
1 |
tggtttgcaattgaattagaatgcacggttattgatannnnnnnaaggagaaaa-ccttgggtaaaatgaggagaaagagaagtggtttgtagaaaccct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34780306 |
tggtttgcaattgaattagaatgcacggttattgatatttttttaaggagaaaaaccttgggtaaaatgaggagaaagagaagtggtttgtagaaaccct |
34780207 |
T |
 |
| Q |
100 |
agcgaagcgattgaagagaaaaaggaagaaacgagcttggggaatgtgagtttt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34780206 |
agcgaagcgattgaagagaaaaaggaagaaacgagcttggggaatgtgagtttt |
34780153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 73 - 152
Target Start/End: Complemental strand, 34767905 - 34767824
Alignment:
| Q |
73 |
gaaagagaagtggtttgtagaaaccctagcgaagcgattgaagagaaaaaggaaga---aacgagcttggggaatgtgagttt |
152 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||||| ||| ||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
34767905 |
gaaagggaagtggttcgtggaaaccctagcgaagcgattggaga-aaaaaggaagaaataacgagcttggagaatatgagttt |
34767824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University