View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_high_16 (Length: 485)
Name: NF0791_high_16
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 161 - 313
Target Start/End: Original strand, 35902676 - 35902828
Alignment:
Q |
161 |
tttagttttaattagattctttatctaatttttagtttcagtttggtcata-tatagtctcattttatattcagtttcgtcttaatgatcctttatattt |
259 |
Q |
|
|
|||||||||| |||| |||||||||| | ||||| ||||||||||||||| |||||||||||||| |||||| ||| ||| |||||||||||||| ||| |
|
|
T |
35902676 |
tttagttttagttaggttctttatcttacttttaaattcagtttggtcataatatagtctcattttttattca-tttagtcctaatgatcctttattttt |
35902774 |
T |
 |
Q |
260 |
tttaaattgttcttttgcttctatgacaaatttaaagatcatgattggtgagga |
313 |
Q |
|
|
|| |||||||||||| ||| |||||||||||||| |||||||| | ||||||| |
|
|
T |
35902775 |
ttcaaattgttctttcacttttatgacaaatttaaggatcatgagttgtgagga |
35902828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 161 - 352
Target Start/End: Original strand, 23892461 - 23892653
Alignment:
Q |
161 |
tttagttttaattagattctttatctaatttttagtttcagtttggtcata-tatagtctcattttatattcagtttcgtcttaatgatcctttatattt |
259 |
Q |
|
|
|||||||||| || | || ||||||| ||||||| | ||||||| ||||| ||| ||||||||||||||||| ||| ||| |||||| ||||||| ||| |
|
|
T |
23892461 |
tttagttttagtttggttatttatcttatttttaaatccagtttgctcataatattgtctcattttatattcaatttagtcctaatgaccctttattttt |
23892560 |
T |
 |
Q |
260 |
tttaaattgttcttttgcttctatgacaaatttaaagatcatgattggtgaggactgaaatttcagaaggaaaacattgcttaacatgtgagg |
352 |
Q |
|
|
|| |||||||||||| ||||||||||||||||||| |||||||| | | ||||| | ||||||| |||| |||||||| | |||||| |||| |
|
|
T |
23892561 |
ttcaaattgttctttcgcttctatgacaaatttaaggatcatgagttgcgaggattacaatttcaaaaggtaaacattgttgaacatgagagg |
23892653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 14 - 59
Target Start/End: Original strand, 7341872 - 7341917
Alignment:
Q |
14 |
atatcatcattccctcaagtccagtaatggctcaacaggtatcatc |
59 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7341872 |
atatcatcattccctcaagtccagtaatggctcaacaggtatcatc |
7341917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University