View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_high_17 (Length: 480)
Name: NF0791_high_17
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 8e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 32 - 101
Target Start/End: Complemental strand, 35103057 - 35102988
Alignment:
| Q |
32 |
gaccatgtacaaataaccaaatttagagatggagatggaagtggtgaagcctgaccaattctagtagcct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
35103057 |
gaccatgtacaaataaccaaatttagagatagagatggaaatggcgaagcctgaccaatactagtagcct |
35102988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University