View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_high_35 (Length: 379)
Name: NF0791_high_35
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_high_35 |
 |  |
|
[»] scaffold1458 (1 HSPs) |
 |  |  |
|
[»] scaffold0515 (1 HSPs) |
 |  |  |
|
[»] scaffold0306 (1 HSPs) |
 |  |  |
|
[»] scaffold0317 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 316; Significance: 1e-178; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 30 - 369
Target Start/End: Complemental strand, 9282870 - 9282531
Alignment:
Q |
30 |
gatgtatcttaaacaagcttcacaacatcacagtagagtggcacatgttcaggagcaccattgtggtggttactctgtgaggggtgcgtataatttgctc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9282870 |
gatgtatcttaaacaagcttcacaacatcacagtagggtggcacatgttcaggagcaccattgtggtggttactctgtgaggggtgcgtataatttgctc |
9282771 |
T |
 |
Q |
130 |
attattcagaactcttattgtgtggaaattaattcaaactaaatttggcaaaaacatgtcccctcccttgaaggtctctattttgacttggcggctcttt |
229 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||| |
|
|
T |
9282770 |
attattcagaattcttattgtgtggaaattaattcaaactaaatttggcaaaaacatgtcccctcccttgaaggtctctatttaggcttggaggctcttt |
9282671 |
T |
 |
Q |
230 |
ggcaataggttaccgactagagacaatttgctgatgtttagcatcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactc |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9282670 |
tgcaataggttaccgactagagacaatttgctgatgtttagcatcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactc |
9282571 |
T |
 |
Q |
330 |
atcacttgttcctttcttcccccgttttcgcccctctgtg |
369 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9282570 |
atcacttgttcctttcttcccccgttttcgcccctctgtg |
9282531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 271 - 366
Target Start/End: Complemental strand, 10442155 - 10442061
Alignment:
Q |
271 |
catcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgttttcgcccctct |
366 |
Q |
|
|
||||||||| |||||| ||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| |||| |
|
|
T |
10442155 |
catcatttctcatgacgctcaattttgt-tgaccggatgcggtggattggaaacagctcatcacttgttccttttttgccccgttttcgcctctct |
10442061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 103; Significance: 4e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 90 - 369
Target Start/End: Complemental strand, 18187322 - 18187047
Alignment:
Q |
90 |
ttgtggtggttactctgtgaggggtgcgtataatttgctcattattcagaactcttattgtgtggaaattaattcaaactaaatttggcaaaaacatgtc |
189 |
Q |
|
|
||||| ||||||||| |||||||||| |||||| ||||||| || |||| ||||| || || || || || |||| ||| |||| ||| ||||| || |
|
|
T |
18187322 |
ttgtgatggttactcggtgaggggtgtgtataacttgctcactagtcaggactctcatggtttgaaagctacttcagacttcatttagcacaaacaggt- |
18187224 |
T |
 |
Q |
190 |
ccctcccttgaaggtctctattttgacttggcggctctttggcaataggttaccgactagagacaatttgctgatgtttagcatcatttcccatgactct |
289 |
Q |
|
|
|||||||||||||| | ||||| ||||| |||| |||| |||||||||||||||| ||||||||| || | || ||||||||| ||||||||| |
|
|
T |
18187223 |
---tcccttgaaggtctttgttttggcttggaggcttattggtaataggttaccgactaaggacaatttggtgtcgcgtaacatcatttctcatgactct |
18187127 |
T |
 |
Q |
290 |
caattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgttttcgcccctctgtg |
369 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
T |
18187126 |
caattttgtgtgactggttgcggtggattggaaacaacgcatcacttgttcctttctttccccgttttcgcccctttgtg |
18187047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 193 - 364
Target Start/End: Original strand, 24838132 - 24838303
Alignment:
Q |
193 |
tcccttgaaggtctctattttgacttggcggctctttggcaataggttaccgactagagacaatttgctgatgtttagcatcatttcccatgactctcaa |
292 |
Q |
|
|
|||||| ||||||||||||||| ||||| | || || | ||||||||||| | || ||||||||| |||||| ||||||||||| |||||||||||| |
|
|
T |
24838132 |
tccctttaaggtctctattttggcttggagccttattcgtaataggttaccaattaaggacaatttggtgatgtgcagcatcatttctcatgactctcaa |
24838231 |
T |
 |
Q |
293 |
ttttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgttttcgcccct |
364 |
Q |
|
|
|||||||||||||| |||||||||||||||| | | ||||||||||| | ||||| ||| |||||||||||| |
|
|
T |
24838232 |
ttttgtgtgactggctgcggtggattggaaatagcacatcacttgtttcattcttgccctgttttcgcccct |
24838303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1458 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold1458
Description:
Target: scaffold1458; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 271 - 357
Target Start/End: Complemental strand, 207 - 121
Alignment:
Q |
271 |
catcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgtttt |
357 |
Q |
|
|
||||||||| ||||||||||||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
T |
207 |
catcatttctcatgactctcaattttgtgtgtctagatgtggtggattggaaacagctcatcacttgttcctttcttgccccgtttt |
121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 271 - 357
Target Start/End: Complemental strand, 2154 - 2068
Alignment:
Q |
271 |
catcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgtttt |
357 |
Q |
|
|
||||||||| ||||||||||||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
T |
2154 |
catcatttctcatgactctcaattttgtgtgtctagatgtggtggattggaaacagctcatcacttgttcctttcttgccccgtttt |
2068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 271 - 357
Target Start/End: Complemental strand, 2154 - 2068
Alignment:
Q |
271 |
catcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgtttt |
357 |
Q |
|
|
||||||||| ||||||||||||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
T |
2154 |
catcatttctcatgactctcaattttgtgtgtctagatgtggtggattggaaacagctcatcacttgttcctttcttgccccgtttt |
2068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0317 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 271 - 357
Target Start/End: Original strand, 17556 - 17640
Alignment:
Q |
271 |
catcatttcccatgactctcaattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttcttcccccgtttt |
357 |
Q |
|
|
||||||||| |||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
T |
17556 |
catcatttctcatgactctcaattttgtgt--ctagatgcggtggattggaaacagctcatcacttgttcctttcttgccccgtttt |
17640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 91
Target Start/End: Original strand, 40171195 - 40171256
Alignment:
Q |
30 |
gatgtatcttaaacaagcttcacaacatcacagtagagtggcacatgttcaggagcaccatt |
91 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
40171195 |
gatgtatcttaaataagcttcacaacatcacagtagagtgacgcatgttcaggagcaccatt |
40171256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 334
Target Start/End: Original strand, 9947257 - 9947307
Alignment:
Q |
284 |
gactctcaattttgtgtgactggatgcggtggattggaaacaactcatcac |
334 |
Q |
|
|
|||||||||||||||||||| | |||| |||||||||||||| |||||||| |
|
|
T |
9947257 |
gactctcaattttgtgtgacagaatgcagtggattggaaacagctcatcac |
9947307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 308 - 369
Target Start/End: Complemental strand, 15143295 - 15143234
Alignment:
Q |
308 |
tgcggtggattggaaacaactcatcacttgttcctttcttcccccgttttcgcccctctgtg |
369 |
Q |
|
|
||||||||| |||||||||| ||||||||||||||||||| ||||| |||||||||| |||| |
|
|
T |
15143295 |
tgcggtggagtggaaacaacacatcacttgttcctttcttgccccgctttcgcccctttgtg |
15143234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 204 - 304
Target Start/End: Complemental strand, 15143630 - 15143530
Alignment:
Q |
204 |
tctctattttgacttggcggctctttggcaataggttaccgactagagacaatttgctgatgtttagcatcatttcccatgactctcaattttgtgtgac |
303 |
Q |
|
|
||||||||||||||||| |||| || | || |||||| |||||| ||||||||| ||| || || |||||||| || | ||| |||||||||||||| |
|
|
T |
15143630 |
tctctattttgacttggaggcttattcgtaacaggttatcgactaaggacaatttggtgacgtgtaagatcatttctcacgcctcacaattttgtgtgac |
15143531 |
T |
 |
Q |
304 |
t |
304 |
Q |
|
|
| |
|
|
T |
15143530 |
t |
15143530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 282 - 346
Target Start/End: Original strand, 31851785 - 31851849
Alignment:
Q |
282 |
atgactctcaattttgtgtgactggatgcggtggattggaaacaactcatcacttgttcctttct |
346 |
Q |
|
|
|||||||||||||||| |||| ||| ||||||||||||| ||||| |||||| ||||||||||| |
|
|
T |
31851785 |
atgactctcaattttgcgtgattggccgcggtggattggacacaacgcatcacatgttcctttct |
31851849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University