View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_high_66 (Length: 272)
Name: NF0791_high_66
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_high_66 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 75 - 264
Target Start/End: Complemental strand, 4403991 - 4403802
Alignment:
| Q |
75 |
catgaggccatgtcaagtgttccatggggtttatcgttcccatggcctcgcaaggggtacacctctgtcataaaggtctttatagtcaaaaacatgtcca |
174 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403991 |
catgaggccatgtcaagtgtcccatggggtttatcgttcccatggcctcgcaaggggtacacctctgtcataaaggtctttatagtcaaaaacatgtcca |
4403892 |
T |
 |
| Q |
175 |
caatctcatttacacccaaaatctcattcactctttccctcacgctttttgtcttccccagcaaaccaatcatgtttttcttttcttttc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4403891 |
caatctcatttacacccaaaatctcattcactctttccctcacgctttttgtcttccccagcaaaccaatcatgtttttcttttcttttc |
4403802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4405258 - 4405202
Alignment:
| Q |
30 |
cataatgtttctcaggggtatggccatgacatatcgtcagaaaagcatgaggccatg |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405258 |
cataatgtttctcaggggtatggccatgacatatcgtcagaaaagcatgaggccatg |
4405202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 180 - 254
Target Start/End: Complemental strand, 21155372 - 21155298
Alignment:
| Q |
180 |
tcatttacacccaaaatctcattcactctttccctcacgctttttgtcttccccagcaaaccaatcatgtttttc |
254 |
Q |
| |
|
|||||||||||||||| ||||| |||||| |||||| | |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
21155372 |
tcatttacacccaaaaattcatttactcttcccctcatgtttttcttcttccccagcaacccaatcatgtttttc |
21155298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University