View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_high_76 (Length: 258)
Name: NF0791_high_76
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_high_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 141 - 240
Target Start/End: Original strand, 28243866 - 28243965
Alignment:
Q |
141 |
gttatcagggtgatctttgtttagagagagtgaagtgcatgatttgatttagtatcagttaaaatgtatctgtagcaaagatggctagatcgggtgggat |
240 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28243866 |
gttaccagggtgatctttgtttagagagagtgaagtgaatgatttgatttggtatcagttaaaatgtatctgtagcaaagatggctagatcgggtgggat |
28243965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 28243726 - 28243769
Alignment:
Q |
1 |
ttcttcatcatttactccattttacttgatcttacctatttatc |
44 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28243726 |
ttcttcatcatttactccattttacttgatcttacctatttatc |
28243769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University