View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_high_76 (Length: 258)

Name: NF0791_high_76
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_high_76
NF0791_high_76
[»] chr8 (2 HSPs)
chr8 (141-240)||(28243866-28243965)
chr8 (1-44)||(28243726-28243769)


Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 141 - 240
Target Start/End: Original strand, 28243866 - 28243965
Alignment:
141 gttatcagggtgatctttgtttagagagagtgaagtgcatgatttgatttagtatcagttaaaatgtatctgtagcaaagatggctagatcgggtgggat 240  Q
    |||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
28243866 gttaccagggtgatctttgtttagagagagtgaagtgaatgatttgatttggtatcagttaaaatgtatctgtagcaaagatggctagatcgggtgggat 28243965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 28243726 - 28243769
Alignment:
1 ttcttcatcatttactccattttacttgatcttacctatttatc 44  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
28243726 ttcttcatcatttactccattttacttgatcttacctatttatc 28243769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University