View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_high_77 (Length: 256)

Name: NF0791_high_77
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_high_77
NF0791_high_77
[»] chr2 (1 HSPs)
chr2 (35-240)||(8002433-8002638)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 35 - 240
Target Start/End: Complemental strand, 8002638 - 8002433
Alignment:
35 aaaactaccttgaatctcattgatatgtggggattgactttgtaggagtggcagttgggtgcggatggcaagccattgtggcttatataaacgtaggctg 134  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
8002638 aaaactacgttgaatctcattgatatgtggggattgactttgtaggagtggcagttgggtgcggatggcaagccattgtggcttatataaacgtaggatg 8002539  T
135 ttattatggggttggagtccctgtgggttgtgttttaggcttcaaattcaacctgggtgttaaggtatgatactagtagtgattcatgttacaactaatc 234  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
8002538 ttattatggggttggagtcccagtgggttgtgttttaggcttcaaattcaaccttggtgttaaggtatgatactagtagtgattcatgttacaactaatc 8002439  T
235 gttcat 240  Q
    ||||||    
8002438 gttcat 8002433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University