View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_high_94 (Length: 207)
Name: NF0791_high_94
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_high_94 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 30256215 - 30256277
Alignment:
Q |
17 |
acacaattgttatgattcttttgtatcaagaattttctttgtttctctgcttatgatcctttg |
79 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
30256215 |
acacaattgttatgattcttttgtatcaagaattttctttgtttctctgtttatgatcctttg |
30256277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 34899808 - 34899761
Alignment:
Q |
160 |
tgaaagatatgtatcttccaactacaaaatttactatgaatttgtgca |
207 |
Q |
|
|
|||||| ||||||||||||||||||||||||| | |||||||||||| |
|
|
T |
34899808 |
tgaaaggtatgtatcttccaactacaaaattttatgtgaatttgtgca |
34899761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University