View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_108 (Length: 256)
Name: NF0791_low_108
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 35 - 240
Target Start/End: Complemental strand, 8002638 - 8002433
Alignment:
| Q |
35 |
aaaactaccttgaatctcattgatatgtggggattgactttgtaggagtggcagttgggtgcggatggcaagccattgtggcttatataaacgtaggctg |
134 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8002638 |
aaaactacgttgaatctcattgatatgtggggattgactttgtaggagtggcagttgggtgcggatggcaagccattgtggcttatataaacgtaggatg |
8002539 |
T |
 |
| Q |
135 |
ttattatggggttggagtccctgtgggttgtgttttaggcttcaaattcaacctgggtgttaaggtatgatactagtagtgattcatgttacaactaatc |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8002538 |
ttattatggggttggagtcccagtgggttgtgttttaggcttcaaattcaaccttggtgttaaggtatgatactagtagtgattcatgttacaactaatc |
8002439 |
T |
 |
| Q |
235 |
gttcat |
240 |
Q |
| |
|
|||||| |
|
|
| T |
8002438 |
gttcat |
8002433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University