View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_110 (Length: 254)
Name: NF0791_low_110
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_110 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 4654309 - 4654094
Alignment:
| Q |
30 |
cagacggatgatgaaagtacgtttctccgtagggaggaaataggcagtgatgggagggttgctggttgctgaaatacaagttgctggtgtcggcgaggga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4654309 |
cagacggatgatgaaagtacgtttctccgtagggaggaaataggcagtgatgggagggttgctggttgctgaaatacaagttgccggtgtcggcgaggga |
4654210 |
T |
|
| Q |
130 |
atcacctcgccgaagctgaagatggaagagcaggaagaggatgccatgactaatgatgcagaagccattactacaagtagtagtatcaatgtactccatc |
229 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4654209 |
atcacc-----gaagctgaagatggaagagcaggaagaggatgccatgactaatgatgcagaagccattactacaagtagtagtatcaatgtactccatc |
4654115 |
T |
|
| Q |
230 |
gcttttcagaagccatgacta |
250 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4654114 |
gcttttcagaagccatgacta |
4654094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 159
Target Start/End: Complemental strand, 4633064 - 4632940
Alignment:
| Q |
30 |
cagacggatgatgaaagtacgtttctccgtagggaggaaataggcagtgatgggagggttgctggttgctgaaatacaagttgctggtgtcggcgaggga |
129 |
Q |
| |
|
||||||||||||||||||| |||| || |||||||| || | ||||||| |||||| | ||| ||||| ||||| ||||| |||||||| | ||| |
|
|
| T |
4633064 |
cagacggatgatgaaagtaagtttggccatagggagggaagaaacagtgatcagagggtggttgggagctgagatacaggttgccagtgtcggcaatgga |
4632965 |
T |
|
| Q |
130 |
atcacctcgccgaagctgaagatggaagag |
159 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
4632964 |
atca-----ccgaagctgaagatggaagag |
4632940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University