View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_114 (Length: 251)
Name: NF0791_low_114
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_low_114 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 38421239 - 38421180
Alignment:
Q |
192 |
gttggtataaattcctttcttcatagccacactaataatatggtggaagctgaattctaa |
251 |
Q |
|
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
38421239 |
gttgctataaattcctttcttcaaagccacactaataatatggtggaagctgaattctaa |
38421180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 89
Target Start/End: Complemental strand, 38421497 - 38421460
Alignment:
Q |
52 |
taaaatacattaaatatactctttgatgataaagacat |
89 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
38421497 |
taaaatacattaaatatactctttgatgataaagacat |
38421460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University