View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_114 (Length: 251)

Name: NF0791_low_114
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_114
NF0791_low_114
[»] chr3 (2 HSPs)
chr3 (192-251)||(38421180-38421239)
chr3 (52-89)||(38421460-38421497)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 38421239 - 38421180
Alignment:
192 gttggtataaattcctttcttcatagccacactaataatatggtggaagctgaattctaa 251  Q
    |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
38421239 gttgctataaattcctttcttcaaagccacactaataatatggtggaagctgaattctaa 38421180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 89
Target Start/End: Complemental strand, 38421497 - 38421460
Alignment:
52 taaaatacattaaatatactctttgatgataaagacat 89  Q
    ||||||||||||||||||||||||||||||||||||||    
38421497 taaaatacattaaatatactctttgatgataaagacat 38421460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University