View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_117 (Length: 251)
Name: NF0791_low_117
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_117 |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 92191 - 91954
Alignment:
| Q |
14 |
atatgatcttgatgacaaccaacaaaccaaattgaacagatcgaacccacaaactaaaatggtgggacaactttcaatgattagaattcgtccacaagca |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92191 |
atatgatcgtgatgacaaccaacaaaccaaattgaacagatcgaacccacaaactaaaatggtgggacaactttcaatgattagaattcgtccacaagca |
92092 |
T |
 |
| Q |
114 |
tactcaaaagtcagaaaccgtatcagaatagaaacgtgaaacaagaaatgacaactcgcgagatatgaagaaggaccattagcaagcgagttttgaagaa |
213 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92091 |
tattcaaaagtcataaaccgtatcagaatagaaacgtgaaacaagaaatgacaactcgcgagatatgaagaaggaccattagcaagcgagttttgaagaa |
91992 |
T |
 |
| Q |
214 |
ccaaacacaagcatatcccaaatcatgagataccacaa |
251 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
91991 |
ccaaacacaagcacaacccaaatcatgagataccacaa |
91954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University