View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_128 (Length: 224)
Name: NF0791_low_128
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_128 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 75 - 224
Target Start/End: Original strand, 23522280 - 23522429
Alignment:
| Q |
75 |
gtgggtagataatactattgagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc |
174 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522280 |
gtgggtatatactactatagagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc |
23522379 |
T |
 |
| Q |
175 |
ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522380 |
ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgt |
23522429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University