View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_131 (Length: 223)
Name: NF0791_low_131
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_131 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 40894802 - 40894662
Alignment:
| Q |
1 |
gttaactgtgctaatctggccgctagacttgccacttcagttgctgtattggccttccacgtaggcaaatgactaaattgat-gatgtccatgtaggcga |
99 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40894802 |
gttaactatgctaatctggccgctagacttgccacttcagttgctgtattggccttccacgtaggcaaatgactaaattgatggatgtccatgtaggcga |
40894703 |
T |
 |
| Q |
100 |
gagggaccaaaatgaccataattatgttactaccttcatct |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40894702 |
gagggaccaaaatgaccataattatgttactaccttcatct |
40894662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 37464919 - 37464780
Alignment:
| Q |
1 |
gttaactgtgctaatctggccgctagacttgccacttcagttgctgtattggccttccacgtaggcaaatgactaaattgatg-atgtccatgtaggcga |
99 |
Q |
| |
|
||||| |||| | ||||||| |||||||||||||||||||||||||||||||| |||||| | ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
37464919 |
gttaattgtgttgatctggctgctagacttgccacttcagttgctgtattggcattccacacatgcaaa-gactaaattgatggatgtccatgtaggcga |
37464821 |
T |
 |
| Q |
100 |
gagggaccaaaatgaccataattatgttactaccttcatct |
140 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
37464820 |
gagggaccaaactgaccataattatgttactgtcttcatct |
37464780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 42537846 - 42537905
Alignment:
| Q |
1 |
gttaactgtgctaatctggccgctagacttgccacttcagttgctgtattggccttccac |
60 |
Q |
| |
|
||||| |||| | ||||||| ||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
42537846 |
gttaattgtgttgatctggctgctagacttgccacttcagctgctgtattggcattccac |
42537905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University