View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_131 (Length: 223)

Name: NF0791_low_131
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_131
NF0791_low_131
[»] chr2 (1 HSPs)
chr2 (1-140)||(40894662-40894802)
[»] chr3 (1 HSPs)
chr3 (1-140)||(37464780-37464919)
[»] chr7 (1 HSPs)
chr7 (1-60)||(42537846-42537905)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 40894802 - 40894662
Alignment:
1 gttaactgtgctaatctggccgctagacttgccacttcagttgctgtattggccttccacgtaggcaaatgactaaattgat-gatgtccatgtaggcga 99  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40894802 gttaactatgctaatctggccgctagacttgccacttcagttgctgtattggccttccacgtaggcaaatgactaaattgatggatgtccatgtaggcga 40894703  T
100 gagggaccaaaatgaccataattatgttactaccttcatct 140  Q
    |||||||||||||||||||||||||||||||||||||||||    
40894702 gagggaccaaaatgaccataattatgttactaccttcatct 40894662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 37464919 - 37464780
Alignment:
1 gttaactgtgctaatctggccgctagacttgccacttcagttgctgtattggccttccacgtaggcaaatgactaaattgatg-atgtccatgtaggcga 99  Q
    ||||| |||| | ||||||| |||||||||||||||||||||||||||||||| ||||||  | ||||| ||||||||||||| ||||||||||||||||    
37464919 gttaattgtgttgatctggctgctagacttgccacttcagttgctgtattggcattccacacatgcaaa-gactaaattgatggatgtccatgtaggcga 37464821  T
100 gagggaccaaaatgaccataattatgttactaccttcatct 140  Q
    ||||||||||| |||||||||||||||||||  ||||||||    
37464820 gagggaccaaactgaccataattatgttactgtcttcatct 37464780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 42537846 - 42537905
Alignment:
1 gttaactgtgctaatctggccgctagacttgccacttcagttgctgtattggccttccac 60  Q
    ||||| |||| | ||||||| ||||||||||||||||||| |||||||||||| ||||||    
42537846 gttaattgtgttgatctggctgctagacttgccacttcagctgctgtattggcattccac 42537905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University