View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_137 (Length: 207)

Name: NF0791_low_137
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_137
NF0791_low_137
[»] chr5 (1 HSPs)
chr5 (17-79)||(30256215-30256277)
[»] chr3 (1 HSPs)
chr3 (160-207)||(34899761-34899808)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 30256215 - 30256277
Alignment:
17 acacaattgttatgattcttttgtatcaagaattttctttgtttctctgcttatgatcctttg 79  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
30256215 acacaattgttatgattcttttgtatcaagaattttctttgtttctctgtttatgatcctttg 30256277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 34899808 - 34899761
Alignment:
160 tgaaagatatgtatcttccaactacaaaatttactatgaatttgtgca 207  Q
    |||||| |||||||||||||||||||||||||  | ||||||||||||    
34899808 tgaaaggtatgtatcttccaactacaaaattttatgtgaatttgtgca 34899761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University