View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_139 (Length: 203)
Name: NF0791_low_139
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_139 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 39188298 - 39188415
Alignment:
| Q |
1 |
gtaacttggttaccttctcaaatcttttagaagctcttgcatattcacgacgtcagtgcaatgattcccctttttctttcttcttatgagcagcttctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39188298 |
gtaacttggttaccttctcaaatcttttagaagctcttgcatattcacgacgtcggtgcaatgattcccctttttctttcttcttatgagcagcttctca |
39188397 |
T |
|
| Q |
101 |
cttctctttattgttcat |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39188398 |
cttctctttattgttcat |
39188415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 2875822 - 2875868
Alignment:
| Q |
1 |
gtaacttggttaccttctcaaatcttttagaagctcttgcatattca |
47 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2875822 |
gtaacctggttaccttctgaaatcttttagaagctcttgcatattca |
2875868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 3144966 - 3144920
Alignment:
| Q |
1 |
gtaacttggttaccttctcaaatcttttagaagctcttgcatattca |
47 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3144966 |
gtaacctggttaccttctgaaatcttttagaagctcttgcatattca |
3144920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 2795908 - 2795862
Alignment:
| Q |
1 |
gtaacttggttaccttctcaaatcttttagaagctcttgcatattca |
47 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2795908 |
gtaacatggttaccttctgatatcttttagaagctcttgcatattca |
2795862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 47
Target Start/End: Original strand, 2890311 - 2890348
Alignment:
| Q |
10 |
ttaccttctcaaatcttttagaagctcttgcatattca |
47 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2890311 |
ttaccttctgaaatcttttagaagctcttgcatattca |
2890348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 3159541 - 3159501
Alignment:
| Q |
7 |
tggttaccttctcaaatcttttagaagctcttgcatattca |
47 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
3159541 |
tggttaccttctgaaatctcttggaagctcttgcatattca |
3159501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 45
Target Start/End: Original strand, 3494363 - 3494399
Alignment:
| Q |
9 |
gttaccttctcaaatcttttagaagctcttgcatatt |
45 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
3494363 |
gttaccttctcatatcttttagaagcttttgcatatt |
3494399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University