View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_143 (Length: 202)

Name: NF0791_low_143
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_143
NF0791_low_143
[»] chr4 (1 HSPs)
chr4 (1-106)||(53592502-53592605)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 53592605 - 53592502
Alignment:
1 gatgacaagaagaaagatgtttgtttgatattatcttttagaaggaagcatataggaaacacgcgatacaaccttacttgcattgctgttctcttcaagt 100  Q
    |||||||| |||||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
53592605 gatgacaataagaaagatgtttgtttgattttatcttt--gaaggaagcatataggaaacacgcgatacaaccttacttgcattgttgttctcttcaagt 53592508  T
101 agttgg 106  Q
    ||||||    
53592507 agttgg 53592502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University