View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_42 (Length: 394)
Name: NF0791_low_42
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 71 - 346
Target Start/End: Complemental strand, 53209294 - 53209019
Alignment:
| Q |
71 |
gtttaaggatgtgacttttctttcctttgctcttctgaattgtacctatctttgattttagtgatgcatatttagttggatgtattgacattggacgttc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53209294 |
gtttaaggatgtgacttttctttcctttgctcttctgaattgtacctatctttgattttagtgatgcatatttagttggatgtattgacattggacgttc |
53209195 |
T |
 |
| Q |
171 |
aactgcaagccattgttttctttattgagtgttagtttcgtggaggtcaagaaacatcaaacaatgtcttgctctcttctgctgaggcaaagtatagatc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53209194 |
aactgcaagccattgttttctttattgagtgttagtttcgtggaggtcaagaaacatcaaacaatgtcttgctctcttctgctgaggcaaagtatagatc |
53209095 |
T |
 |
| Q |
271 |
agctttagcctctacaactagataacttcaatggattttctttcttcttcaagatttgggtcagcaacctatgata |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53209094 |
agctttagcctctacaactagataacttcaatggattttctttcttcttcaagatttgggtcagcaacctatgata |
53209019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University