View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_43 (Length: 393)
Name: NF0791_low_43
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_43 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 112 - 393
Target Start/End: Complemental strand, 43232046 - 43231766
Alignment:
| Q |
112 |
agacatcagacacaacatcctaccccgagcacattttgtaatatgttaaattttatatcaattttcccctctcttctgaactcaaacacaataaaaattt |
211 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
43232046 |
agacatcagacacaacaccctaccccaagaacattttgtaatattttaaattttatatcaattttccc-tctcttctgaactcaaacacgataaaaattt |
43231948 |
T |
 |
| Q |
212 |
gaaagtgtcaaaattatctcgaaatatcaatgttgttttttcaatgagttgcaatgaatgaggattgtttcaaggactcgtggctcactaaagtgaattc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43231947 |
taaagtgtcaaaattatctcgaaatatcaatgttgttttttcaatgagttgcaatgaatgaggattgtttcaaggactcgtggatcactaaagtgaattc |
43231848 |
T |
 |
| Q |
312 |
taaaatttatatttcttgctattattttgatgagtcataaaatacaatttatttttcataaagtaaaataaaaatcaaagtc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231847 |
taaaatttatatttcttgctattattttgatgagtcataaaatacaatttatttttcataaagtaaaataaaaatcaaagtc |
43231766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University