View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_53 (Length: 348)
Name: NF0791_low_53
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_low_53 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 30 - 348
Target Start/End: Complemental strand, 7973458 - 7973140
Alignment:
Q |
30 |
ttgatcatattgaacatgctgccatttcaaaaggacagtttgaaaacctattttgctgcaacccctgagtctccctaatttaatttgatcttggatcttg |
129 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7973458 |
ttgatcatattgaacatgctgccatctcaaaaggacagtttgaaaacctattttgctgcaacccctgagtctccctaatttaatttgatcttggatcttg |
7973359 |
T |
 |
Q |
130 |
tgctatattattgtgtacagagaattcagagtactgctttcaaattcagtcctcttcttgtgaatttatgtcttctcattttcattgtcagagtaaccgt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
7973358 |
tgctatattattgtgtacagagaattcagagtactgctttcaaattcagtcctcttcttgtgaatttatgtcttctcattttcattgtcagaataaccgt |
7973259 |
T |
 |
Q |
230 |
aagattttggtaacatttcttcactttttcacctattttttggatagatgcttccccttccacttcttcccttcacaaagatgctatcaaatagggtaca |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7973258 |
aagattttggtaacatttcttcactttttcaccttttttttggatagatgcttccccttccacttcttcccttcacaaagatgctatcaaatagggtaca |
7973159 |
T |
 |
Q |
330 |
aagttgaagataaactaca |
348 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
7973158 |
aagttgaagataaactaca |
7973140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University