View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_54 (Length: 348)
Name: NF0791_low_54
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 2 - 248
Target Start/End: Original strand, 34143543 - 34143789
Alignment:
Q |
2 |
ccatgatttgtaacttggaagaaaccccattccttgcaagcacttgatatctctttgactaaggcttgtatggcagaggagtcttgaactgtgttgtgga |
101 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34143543 |
ccatgatttgtaacttggaagaaaccccattccttgcaagcacttgatatctctttgactaaggcttgtatggcagaggagtcttgaactgtgttgtgga |
34143642 |
T |
 |
Q |
102 |
ttattggggagaggttgattacgggaatgccttcagcttgggtgatggagagttttggtctgttttatgggttttgaatgaaagcttgatccacctcttc |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
34143643 |
ttattggggagaggttgattacgggaatgccttcagcttgggtgatggagagttttggtctgttttctgggttttgaatgaaagcttgatccacctcttc |
34143742 |
T |
 |
Q |
202 |
catgtttcctgctaccactaaactaataattcaaacattgattacta |
248 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34143743 |
catgtttcctgctaccactaaactaataattcaaacattgattacta |
34143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University