View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_56 (Length: 343)
Name: NF0791_low_56
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 79 - 144
Target Start/End: Complemental strand, 25520453 - 25520388
Alignment:
| Q |
79 |
agcagcacagacagagattgaagtggaacagctcaattatttcatcatggtaaatatattgagatt |
144 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520453 |
agcatcactgacagagattgaagtggaacagctcaattatttcatcatggtaaatatattgagatt |
25520388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 149 - 265
Target Start/End: Original strand, 42141666 - 42141783
Alignment:
| Q |
149 |
aatagttgttatgattacatatatgaataaggtatgttggcctcatt--cttgaattttttgtggtatgtaatgtctagacaaaataggaagaaaataat |
246 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||| ||||| || || |||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
42141666 |
aatagttgttatgattgcacatatgaataaggtaggttggtgtcattttctcaaagtttttgtgttatgta-tgtctagacaaaataggaataaaataat |
42141764 |
T |
|
| Q |
247 |
tggagaagagaaaatctat |
265 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
42141765 |
tggagaagagaaaaactat |
42141783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 104 - 140
Target Start/End: Original strand, 42133397 - 42133433
Alignment:
| Q |
104 |
gaacagctcaattatttcatcatggtaaatatattga |
140 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |
|
|
| T |
42133397 |
gaacagctcaattatttcatcatggttagtatattga |
42133433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University