View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_57 (Length: 342)
Name: NF0791_low_57
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_57 |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 85 - 331
Target Start/End: Original strand, 91777 - 92027
Alignment:
| Q |
85 |
atgatgaacaaaatagatacatatccaattatatattttctttccccaagaaattttccgaaaatggttgtactaatatcaccattgcacaaccatgaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91777 |
atgatgaacaaaatagatacatatccaattatatattttccttccccaaaaaattgtccgaaaatggttgtactaatatcaccattgcacaaccatgaag |
91876 |
T |
 |
| Q |
185 |
cattaaccgtggtcgca----taactcgaaaaggtctgtaaatctccggcaactactcggtcatttcatctttccgattgtggtatctcatgatttggga |
280 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91877 |
cattaaccgtggtcgcacgcataactcgaaaaggtctgtaaatctccggcacctactcggtcatttcatctttccgattgtggtatctcatgatttgggt |
91976 |
T |
 |
| Q |
281 |
tatgcttgtgtttggttcttcaaaactcgcttgctaatggtccttcttcat |
331 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91977 |
tgtgcttgtgtttggttcttcaaaactcgcttgctaatggtccttcttcat |
92027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University