View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_69 (Length: 322)
Name: NF0791_low_69
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 55 - 236
Target Start/End: Original strand, 38749090 - 38749278
Alignment:
| Q |
55 |
atccgtttctcttccttgacttagtatagtt--ttaccctacaaattctcattcataactccataatttgctggataagcatgcgataaaattgttgggg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38749090 |
atccgtttctcttccttgacttagtatagttagttaccctacaaattctcattcataactccataatttgctggataagcatgcgataaaattgttgggg |
38749189 |
T |
|
| Q |
153 |
catgactcatgatcaggtctaagatatgg----tatattgag-taaaaacaattacataaatgagttgcaaatcaaatcttatcttaac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
38749190 |
catgactcatgatcaggtctaagatatggcatatatattgagctaaaaacaattgcataaataagttgcaaatcaaatcttatcttaac |
38749278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University