View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_70 (Length: 321)
Name: NF0791_low_70
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 39 - 218
Target Start/End: Original strand, 52823762 - 52823941
Alignment:
Q |
39 |
ttttgaacgggacgtcaataaacaaatgaaatgaaatgtgcacattatttattttattggttctgttcaactatgctttttgcaattaaaataaaaatat |
138 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
52823762 |
ttttgaacgggacgtcaataaacaaatgaaatgaaatgtgcacattatttattttattggttctgttcaactatgatttttgcaattaaaataaaaatat |
52823861 |
T |
 |
Q |
139 |
attagtgcccccacaggcacagaccaagtggtggaggaatcaggtacgtacatacaaacagttctttctctataatatga |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52823862 |
attagtgcccccacaggcacagaccaagtggtggaggaatcaggtacgtacatacaaacagttctttctctataatatga |
52823941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University