View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_78 (Length: 307)
Name: NF0791_low_78
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_78 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 15334330 - 15334612
Alignment:
| Q |
1 |
tggattcgggtcaggaaacgggctgaactgaggaggatcaataactatttcgggtggcacacttgggtctacttcaggttcacgtgttggaatggttgga |
100 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15334330 |
tggattcgggtcatgaaacgggttgaactgaggaggatcaataactatttcgggtggcacacttgggtctacttcaggttcacgtgttggaatggttggg |
15334429 |
T |
|
| Q |
101 |
ttctctctaggaaatgaaggaggttcggtttcgggtttaaaggggaattcgggtgggcctttacccgggtattcgggtatattattactatttgagaaaa |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15334430 |
ttctctttaggaaatgaaggaggttcggtttcgggtttaaaggggaattcgggtgggcctttacccgggtattcgggtatattattactatttgagaaaa |
15334529 |
T |
|
| Q |
201 |
gaggcgatgtagggatagaaagtgatgatggaggttttttggaggataaatttgtgatgtagagaggtttggtgattgtgatg |
283 |
Q |
| |
|
||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||| |
|
|
| T |
15334530 |
gagccgatgtagggatacaaagtaatgatggaggttttttggaggataaatttgtggtgtagagaggtttggtaattgggatg |
15334612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University