View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_79 (Length: 305)
Name: NF0791_low_79
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 88 - 223
Target Start/End: Original strand, 44574450 - 44574585
Alignment:
| Q |
88 |
atttttgggaaggaaattgcatgtcccactaaataactgttctccaagctcatccaagtgattcttgagctctgatggtcccaagttggaggacacgtct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44574450 |
atttttgggaaggaaattgcatgtcccactaaataactgttctccaagctcatccaggtgattcttgagctctgatggtaccaagttggaggacacgtct |
44574549 |
T |
|
| Q |
188 |
tgctttaccaacaataaatctttccctcctatgcta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44574550 |
tgctttaccaacaataaatctttccctccaatgcta |
44574585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University