View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_85 (Length: 295)
Name: NF0791_low_85
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 34 - 285
Target Start/End: Original strand, 45579207 - 45579458
Alignment:
| Q |
34 |
tcttaacgtggtgcatgtatctcttgtgatattattgtatactttatgagcctgtccggcccgttcctactgcaacttgtgataaataaattaagagata |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
45579207 |
tcttaacgtggtgcatgtatctcttgtgatattattgtatactttatgaggctgtccggcccgttcctactgcaacttgtaataaataaaataagagata |
45579306 |
T |
 |
| Q |
134 |
ttgtttttaatttaaaagtcatta-cttcattatagttgtccaattctttttgtaaatttggtcttgtttttatnnnnnnngtatcaaagaaggatagag |
232 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
45579307 |
ttgtttttaatttaaaagttattagcatcattatagttgtccaattctttttgtaaatttggtcttgtttttat-aaaaaagtatcagagaaggatagag |
45579405 |
T |
 |
| Q |
233 |
aattgannnnnnnnactactattgttttctttatgtggagttttcaccctatg |
285 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
45579406 |
aattgattttttttactactattgttttctatatgtggagttttcactctatg |
45579458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University