View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_89 (Length: 285)
Name: NF0791_low_89
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 29 - 218
Target Start/End: Original strand, 38748872 - 38749061
Alignment:
| Q |
29 |
atgtggcagtttgttaattcattggggcctaatgttttggctatgtgtaattcgattacaagctctcaattcaacaatatccgtgcctttttggttttgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38748872 |
atgtggcagtttgttaattcattgggacctaatgttttggctatgtgtaattcgattacaagctctcaattcaacaatatccgtgcccttttggttttgg |
38748971 |
T |
 |
| Q |
129 |
gtgacatgaaaattctagatcacgatatatagaattttatgtatagaatacacaaagaggtgtccatgcaatgtactttgatacattgca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38748972 |
gtgacatgaaaattctagatcacgatatatagaattttatgtatagaatacacaaagaggtgtccatgaaatgtactttgatacattgca |
38749061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University