View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_91 (Length: 282)
Name: NF0791_low_91
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0791_low_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 36513772 - 36514023
Alignment:
| Q |
1 |
cacatcttttctcctcaaaaatagctcatatcaatttcttccaatttaaacacacaacgagttcacttgagttgactcgnnnnnnnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36513772 |
cacatcttttctcctcaaaaatagctcatatcaatttcttccaatttaaacacacaacgagttcacttgagttgactcgttcttctcttcttcttct--- |
36513868 |
T |
 |
| Q |
101 |
cgaatccaacgacttcaccaaaacaccgtcgttttaaccgtggatctcgattttagttactgtaatcatgaacaaaacaccgattctcgaaattgaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36513869 |
cgaatccaacgacttcaccaaaacaccgtcgttttaaccgtggatctcgattttagttactgtaatcatgaacaaaacaccgattctcgaaattgaacca |
36513968 |
T |
 |
| Q |
201 |
agggaactcaaattcatatgtgagtgaaaattttcaatttcaaatgcttgtaatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36513969 |
agggaactcaaattcatatgtgagtgaaaattttcaatttcaaatgcttgtaatg |
36514023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University