View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_94 (Length: 275)
Name: NF0791_low_94
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_low_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 68 - 223
Target Start/End: Complemental strand, 54022445 - 54022290
Alignment:
Q |
68 |
catccgaatcttgttaaactacttggctactgttgggaggaaaatcaattcctgctggtttacgagtacatgcaaaagggcagcttggaaagccacctct |
167 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54022445 |
catccgaatcttgttaaactacttggctactgttgggaggaaaatcaattcctgctggtttacgagtacatgcaaaagggcagcttggaaagccacctct |
54022346 |
T |
 |
Q |
168 |
tcagaagtacgaaattaattaatcaatagtatgtattagtattaagttaatgaatg |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54022345 |
tcagaagtacgaaattaattaatcaatagtatgtattagtattaagttaatgaatg |
54022290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University