View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0791_low_96 (Length: 271)
Name: NF0791_low_96
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0791_low_96 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 261
Target Start/End: Original strand, 42222876 - 42223121
Alignment:
Q |
17 |
ctttgtctttcgctcgtactttggagtggtcttctttt-ggcgaagggagttgcattgtggtcttctagtttggcttttcctctatttgagatttattga |
115 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
42222876 |
ctttatctttcgctcgtactttggagtggtcttctttttggcgaagggagttgcattgtggtcttctagtttggcttttcctctattcgagatttattga |
42222975 |
T |
 |
Q |
116 |
ctactttagtttacatgttattgcgcaggtgaacgtttaagcccttgggtggccgctggatgttttacaatgggcatatcaattctattcttctgaacct |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
42222976 |
ctactttagtttacatgttattgcgcaggtgaacgtttaagcccttgggtggccgttggatgttttacaatgggcgtatcaattctattcttctgaacct |
42223075 |
T |
 |
Q |
216 |
tactctgacttgaaatggttccattttcctttccattcttctcact |
261 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
T |
42223076 |
tactctgacttgaaatgtttccattttcctttccattcttttcact |
42223121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University