View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_13 (Length: 417)
Name: NF0792_low_13
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0792_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 88 - 407
Target Start/End: Original strand, 33927418 - 33927738
Alignment:
Q |
88 |
gagcaagggtttatttttatttttgttatgttacaattggtttgagacnnnnnnnnnttatataaaggtttttggtatttttgggggaaattattcaatt |
187 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33927418 |
gagcaagggtttatttttatttttgttatgttacaattggtttgagacaaaaaaaaattatataaaggtttttggtatttttgggggaaattattcaatt |
33927517 |
T |
 |
Q |
188 |
ttcttccaactggannnnnnnggttctttatgatgttaatagagtgatttggttgctaatgcaactttttgaattgcttataacttgttactatttattc |
287 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33927518 |
ttcttccaactggattttttttgttctttatgatgttaatagagtgatttggttgctaatgcaactttttgaattgcttataacttgttactatttattc |
33927617 |
T |
 |
Q |
288 |
ttggtctttaaatgcaaaataaataatgtgggaataataatatttgattgctaaaactaattttcttgttagtnnnnnnngaaaagtatcaat-gatatg |
386 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||| |
|
|
T |
33927618 |
ttggtctttaaatgcaaaataaatgatgtgggaataataatatttgattgctaaaactaattttcttgttagtaaaaaaagaaaagtatctatggatatg |
33927717 |
T |
 |
Q |
387 |
cttttgtttaaattgtctgtg |
407 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
33927718 |
cttttgtttaaattgtctgtg |
33927738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University