View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_18 (Length: 359)
Name: NF0792_low_18
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 88 - 339
Target Start/End: Original strand, 32120767 - 32121018
Alignment:
| Q |
88 |
gatgattcttcaagtgggactaatagagaagttcaatgatattcccatggttacaggccttgatcttgcttgttttgctgcagctctactcacttcctca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32120767 |
gatgattcttcaagtgggactaatagagaagttcaatgatattcccatggttacaggccttgatcttgcttgttttgctgcagctctgctcacttcctca |
32120866 |
T |
|
| Q |
188 |
gctaccatttttgtcctctctaagcttaatcaacattaaaataattagcatatatggaaatgatattccaaattcatagttttgtcttaaatttatttat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32120867 |
gctaccatttttgtcctctctaagcttaatcaacattaaaataattaccatatatggaaatgatattccaaattcatagttttctcttaaatttatttat |
32120966 |
T |
|
| Q |
288 |
ttatttatggaacagggtagtagactagtagtatatcttttgtaagccaaaa |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32120967 |
ttatttatggaacagggtagtagactagtagtatatcttttgtaagccaaaa |
32121018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 319 times since January 2019
Visitors: 5835