View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_21 (Length: 328)
Name: NF0792_low_21
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0792_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 259
Target Start/End: Complemental strand, 26480397 - 26480325
Alignment:
Q |
183 |
acgcacaatatattagtatatattttagtgccaaccaattgttctgcaattgatagaaattaatatcactgcctatg |
259 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
26480397 |
acgcacaatatattagtat----tttagtgccaaccaattgttcagcaattgatagaaattaatatcactgcctatg |
26480325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 348 times since January 2019
Visitors: 5835