View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_22 (Length: 326)
Name: NF0792_low_22
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 7622269 - 7622104
Alignment:
| Q |
1 |
atatgcttcatcttatatgtattcggaagaattttgccacctgttactacaattctatctggttcgagagattagctgcacacgagttgcagagtatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622269 |
atatgcttcatcttatatgtattcggaagaattttgccacctgttactacaattctatctggttcgagagattagctgcacacgagttgcagagtatatc |
7622170 |
T |
|
| Q |
101 |
tagtttacgcacataaaatgttaactttgtattgacggagtctaatggtcttgcaatattttggca |
166 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622169 |
tagtttacacacataaaatgttaactttgtattgacggagtctaatggtcttgcaatattttggca |
7622104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 165 - 259
Target Start/End: Complemental strand, 7622158 - 7622064
Alignment:
| Q |
165 |
cataaaatgttaactttgtattgacggagtctaatggtctcacaatattttggcaaatccttcaaatttgtgctattgaaatatttttcgtctct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622158 |
cataaaatgttaactttgtattgacggagtctaatggtcttgcaatattttggcaaatccttcaaatttgtgctattgaaatatttttcgtctct |
7622064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 97 times since January 2019
Visitors: 5830