View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_24 (Length: 319)
Name: NF0792_low_24
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 146 - 277
Target Start/End: Complemental strand, 4222798 - 4222659
Alignment:
| Q |
146 |
ttggagaaccgaccaatggcatggagttgcgtcaatatgttgcatctatagttaaagattaatggattaatgaagtgtttgattt--------tgaggga |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4222798 |
ttggagaaccgaccaatggcatggagttgcgtcaatatgttgcatctatagttaaagattaatggattaatgaagtgtttgattttgaactcatgaggga |
4222699 |
T |
|
| Q |
238 |
tgcaccgtccataggagatgaattgcttaatagaatgaaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4222698 |
tgcaccgtccataggagatgaattgcttaatagaatgaaa |
4222659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 4222886 - 4222817
Alignment:
| Q |
79 |
cagagattttaaccacaaagaaacctaccatgcacatcgacccatatttacagcttttgttatccttttggaga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4222886 |
cagagattttaaccacaaagaaacctacca----caacgacccatatttacagcttttgttatccttttggaga |
4222817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 230
Target Start/End: Original strand, 3908084 - 3908166
Alignment:
| Q |
148 |
ggagaaccgaccaatggcatggagttgcgtcaatatgttgcatctatagttaaagattaatggattaatgaagtgtttgattt |
230 |
Q |
| |
|
|||||||| || ||||| ||||| |||| ||||||||||||||| || |||||||| | |||| ||||||||||||||||| |
|
|
| T |
3908084 |
ggagaaccaacaaatggaatggacttgcctcaatatgttgcatccattgttaaagaagagtggacaaatgaagtgtttgattt |
3908166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 230
Target Start/End: Original strand, 3924118 - 3924182
Alignment:
| Q |
166 |
atggagttgcgtcaatatgttgcatctatagttaaagattaatggattaatgaagtgtttgattt |
230 |
Q |
| |
|
||||| |||| ||||||||||||||| || |||||||| |||||| ||||||||||||||||| |
|
|
| T |
3924118 |
atggacttgcctcaatatgttgcatccattgttaaagaagaatggacaaatgaagtgtttgattt |
3924182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 978 times since January 2019
Visitors: 5822