View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_27 (Length: 296)
Name: NF0792_low_27
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0792_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 46 - 230
Target Start/End: Complemental strand, 47136615 - 47136431
Alignment:
Q |
46 |
cgcttgatctaggggaggctgtaggtaattacagaagtacattattcaatatcatcgatatatttgtcaactgtcaaattctgattgtgactcactttgt |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47136615 |
cgcttgatctaggggaggctgtaggtaattactgaagtacattattcaatatcatcgatatatttgtcaactgtcaaattctgattgtgactcactttgt |
47136516 |
T |
 |
Q |
146 |
aaataaaatttcagcaattggtgcaatatttgctgcaacagattctgtgtgcacgttgcaggtttgtaacaacaatctttactct |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47136515 |
aaataaaatttcagcaattggtgcaatatttgctgcaacagattctgtgtgcacgttgcaggtttgtaacaacaatctttactct |
47136431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 49207802 - 49207751
Alignment:
Q |
157 |
cagcaattggtgcaatatttgctgcaacagattctgtgtgcacgttgcaggt |
208 |
Q |
|
|
|||||||||| ||||||||| | |||||||||||||| ||||| |||||||| |
|
|
T |
49207802 |
cagcaattggagcaatattttcagcaacagattctgtttgcacattgcaggt |
49207751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 36489759 - 36489808
Alignment:
Q |
162 |
attggtgcaatatttgctgcaacagattctgtgtgcacgttgcaggtttg |
211 |
Q |
|
|
||||| ||||||||||| ||||||||||| || ||||| ||||||||||| |
|
|
T |
36489759 |
attggagcaatatttgccgcaacagattccgtttgcacattgcaggtttg |
36489808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University