View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_29 (Length: 294)
Name: NF0792_low_29
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 48 - 294
Target Start/End: Complemental strand, 44266181 - 44265934
Alignment:
| Q |
48 |
agcattgtcaaaattggacttaacctttcattgatcctatctggttagttgtaacaccgtgaacccct-acatcataagctatggcctccggggtcacgg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44266181 |
agcattgtcaaaattggacttaacctttcattgatcctatttggttagttgtaacaccgtgaaccccttacatcataagctatggcctccggggtcacgg |
44266082 |
T |
|
| Q |
147 |
atatgagactgggaatgagctgcttgaccatttaactagttttgggagaaaaactaaattagggcaaagtcatatggaaaagctttcaaccaccacacta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44266081 |
atatgagactgggaatgagctgcttgaccatttaactagttttgggagaaaaactaaattagggcaaagtcatatggaaaagctttcaaccaccacacta |
44265982 |
T |
|
| Q |
247 |
cttgttgacactgtggggcgtttgatacaactgtacaagttcaacttt |
294 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44265981 |
cttgttcacactgtggggcgtttgatacaactgtacaagttcaacttt |
44265934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1138 times since January 2019
Visitors: 5826