View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_34 (Length: 257)
Name: NF0792_low_34
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 24923202 - 24923392
Alignment:
| Q |
1 |
taaaaatttaaagctaacaggatgtataagaaagtaatcataagtaacaagaaatctaatccttttcattaaatttcaatttcaaactatgtcaaattga |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24923202 |
taaaaatttaatgctaacaggatgtataagaaagtaatcataagtaataagaaatgtaatccttttcattaaatttcaatttcaaactatgtcaaattga |
24923301 |
T |
 |
| Q |
101 |
atatccttcaatctcaccgagaattacaagtaagatattaacctaaatatcataacaagaattccagattagaatcgaatattcaaattac |
191 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24923302 |
atatccttcaatctcaacgaaaattacaagtaagatattaacctaaatatcataacaagaattccagattagaatcgcatattcaaattac |
24923392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University