View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_36 (Length: 253)
Name: NF0792_low_36
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0792_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 28168877 - 28169107
Alignment:
Q |
1 |
tcatgcacctttgacttttgctcacagtctttagttattatgcacttctttttgaaatcaatgcttgaaaaagaatcatcatccatcttatggttccaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
28168877 |
tcatgcacctttgacttttgctcacagtctttagttattatgcacttctttttgaaatcagtgcttgaaaaagaatcatcatccatcttagggttccaat |
28168976 |
T |
 |
Q |
101 |
tctttgaatcacacccattcaaaatagggcaatgatcagagagtgatgtccctattacctgtatctttaaatccttgaaatgtctaagccaaccatcttc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28168977 |
tctttgaatcacacccattcaaaatagggcaatgatcagagagtgatgtccctattacatgtatctttaaatccttgaaatgtctaagccaaccatcttc |
28169076 |
T |
 |
Q |
201 |
tacaaacactcgatctaaccaaattgatgat |
231 |
Q |
|
|
|||||||||| |||||||||||||||||||| |
|
|
T |
28169077 |
tacaaacacttgatctaaccaaattgatgat |
28169107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University