View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_43 (Length: 226)
Name: NF0792_low_43
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 44623188 - 44623060
Alignment:
| Q |
1 |
aagttttgaaacatgaatccaacttatattcatccacctttatattgtttctacatgcatctttcataatgtgaatacttgctacaatcaaatatgactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44623188 |
aagttttgaaacatgaatccaacttatattcatccacctttatattgtttctacatgcatctttcataatgtgaatacttgctacaatcaaatatgactc |
44623089 |
T |
 |
| Q |
101 |
tgaatgcttgaaaaaataaacaaattgat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44623088 |
tgaatgcttgaaaaaataaacaaattgat |
44623060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University