View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_46 (Length: 208)
Name: NF0792_low_46
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0792_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 24860399 - 24860279
Alignment:
Q |
1 |
tacattgcatgggacatctctggtggacatgtcaatcctgctgtgacctttgcaatggctgtgggaggacatattagtgtcccaactgctctcttttatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24860399 |
tacattgcatgggacatctctggtggacatgtcaatcctgctgtgacctttgcaatggctgtgggaggacatattagtgtcccaactgctctcttttatt |
24860300 |
T |
 |
Q |
101 |
gggttgctcaacttattgcct |
121 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
24860299 |
gggttgctcaacttattgcct |
24860279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 408 times since January 2019
Visitors: 5835