View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_48 (Length: 205)
Name: NF0792_low_48
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 36676365 - 36676493
Alignment:
| Q |
1 |
gttatgtaagtagtaagtagtaagtaccctttggatgtgagaatctggcattagagagcgaagaatagaaagatactcattcatctgctttcttctatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36676365 |
gttatgtaagtagtaagtagtaagtaccctttggatgtgagaatctggcattagagagcgaagaatagaaagatactcattcatctgctttcttctatta |
36676464 |
T |
|
| Q |
101 |
cgctcaacagcaatgtgagtcattctctg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36676465 |
cgctcaacagcaatgtgagtcattctctg |
36676493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 22 - 129
Target Start/End: Complemental strand, 46921939 - 46921832
Alignment:
| Q |
22 |
aagtaccctttggatgtgagaatctggcattagagagcgaagaatagaaagatactcattcatctgctttcttctattacgctcaacagcaatgtgagtc |
121 |
Q |
| |
|
|||||||||||||| || || || ||||| ||||| | ||||| ||| |||||||||||||| |||||||| || || || || ||||||||||||||| |
|
|
| T |
46921939 |
aagtaccctttggacgtaggattcaggcatgagagatctaagaacagagagatactcattcatttgctttctcctgttgcgttctacagcaatgtgagtc |
46921840 |
T |
|
| Q |
122 |
attctctg |
129 |
Q |
| |
|
|||||||| |
|
|
| T |
46921839 |
attctctg |
46921832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 129
Target Start/End: Original strand, 27300928 - 27300983
Alignment:
| Q |
74 |
tactcattcatctgctttcttctattacgctcaacagcaatgtgagtcattctctg |
129 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||| |||||||||||||| ||||| |
|
|
| T |
27300928 |
tactcattcatctgttttcttcgattgcgctcaactgcaatgtgagtcatcctctg |
27300983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 68 times since January 2019
Visitors: 5829