View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_49 (Length: 205)
Name: NF0792_low_49
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0792_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 28529659 - 28529534
Alignment:
Q |
1 |
attctccagtcgatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaat--ttacaacnnnnnnnngtagcaggagagtactgg |
98 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
T |
28529659 |
attctccagtcaatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaattataacaacaaaagaaagtagcaggagagtactgg |
28529560 |
T |
 |
Q |
99 |
cattttcatattgaaatattattcga |
124 |
Q |
|
|
|||||||||||||||||||| ||||| |
|
|
T |
28529559 |
cattttcatattgaaatatttttcga |
28529534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University