View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0792_low_49 (Length: 205)

Name: NF0792_low_49
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0792_low_49
NF0792_low_49
[»] chr6 (1 HSPs)
chr6 (1-124)||(28529534-28529659)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 28529659 - 28529534
Alignment:
1 attctccagtcgatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaat--ttacaacnnnnnnnngtagcaggagagtactgg 98  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||  | |||||        ||||||||||||||||||    
28529659 attctccagtcaatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaattataacaacaaaagaaagtagcaggagagtactgg 28529560  T
99 cattttcatattgaaatattattcga 124  Q
    |||||||||||||||||||| |||||    
28529559 cattttcatattgaaatatttttcga 28529534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University