View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0792_low_5 (Length: 609)
Name: NF0792_low_5
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0792_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 460; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 460; E-Value: 0
Query Start/End: Original strand, 79 - 577
Target Start/End: Original strand, 31698803 - 31699299
Alignment:
| Q |
79 |
agatgaagaggtagatggagacatagaagaagtgtgaaataggattggatatggaaaccaatactcatttaacataacatacttaaatgcccagatgcaa |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31698803 |
agatgaagaggtagatggagaca--gaagaagtgtgaaataggattggatatggaaaccaatactcatttaacataacatccttaaatgcccagatgcaa |
31698900 |
T |
|
| Q |
179 |
ccatcttgcaagacatttgcaccctttgtgattgtgtgataaaccaaaaaatacactccttggatctgaaatccattttaggctgattgtaaggcatcag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31698901 |
ccatcttgcaagacatttgcaccctttgtgattgtgtgataaacccaaaaatacactccttggatctgaaatccattttaggctgattgtaaggcatcag |
31699000 |
T |
|
| Q |
279 |
aaatgaaaagcaagcatgtccgatgttcttaaatccttgttatgaggtatggtaggaacttattaagtgtggcatggggaatataattagattgcagatg |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31699001 |
aaatgaaaagcaagcatgtccgatgttcttaaatccttgttatgaggtagggtaggaacttattaagtgtggcatggggaatataattagattgctgatg |
31699100 |
T |
|
| Q |
379 |
aacggagtctgttgataggtatacagcaatgtaaaaactgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttat |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699101 |
aacggagtctgttgataggtatacagcaatgcaaaaactgaaatcccattaggaaagcggtatggaggagggatgggcaagtagagttagacccttttat |
31699200 |
T |
|
| Q |
479 |
actatttgtcgatttatattcaaccaaaccattttggttagatgtgctagtcaatctatggatgatgccaaatttattgagaaattgtgcacaggttct |
577 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699201 |
actatttgtcaatttattttcaaccaaaccattttggttagatgtgctagtcaatctatggatgatgccaaatttattgagaaattgtgcacaggttct |
31699299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 958 times since January 2019
Visitors: 5821